Mostrar/Ocultar Blogs / Diarios
Mostrar/Ocultar Fotos / Pics
ESCAPADA DE 6 DIAS A BALI (JUNIO 2011) -Diarios de Viajes de Indonesia- Martuxi78
Diarios más leidos
Diarios más leidos
Últimos Diarios
Últimos Diarios
Diarios más Votados
Diarios más Votados
Diarios por paises
Diarios por paises

Compartir enlaces Compartir enlaces

Enlace:    Corto  Largo
Copia el texto de uno de los cajones para compartir el enlace
Localización: Indonesia Indonesia [Asia]
Martuxi78  Autor:    Fecha creación:  Compartir este diario: 
Descripción: Información y experiencias de un viaje a Bali en junio del 2011, organizado totalmente por libre.

Índice de Etapas del Diario: ESCAPADA DE 6 DIAS A BALI (JUNIO 2011)

Total comentarios: 41  Visualizar todos los comentarios Comenzar a leer Comenzar a leer

Etapas 1 a 3,  total 13
 1  2  3  ..  5  siguiente siguiente

Localización: Indonesia Indonesia
Por fin me he decidido a escribir mi primer diario, no se como saldrá pero espero que os pueda servir de ayuda para futuros viajeros ó al menos que disfrutéis leyéndolo, aunque sea un poquito.

Este viaje a Bali fue nuestro primer contacto con Asia y lo hicimos como siempre hemos hecho: ir por libre.
Decidimos ir a Bali como una prolongación del viaje a Tailandia. Sustituimos el sur de Tailandia (ya que pensamos ir con unos amigos el próximo año) y nos hicimos una escapadita a Bali de 6 días.

Lo primero fue los preparativos del viaje; para esto me ayudo mucho este foro, que es una auténtica maravilla. Los diarios del foro de donde saqué más información fueron: php?b=1760 De Vecogu php?b=1441 De monica31
Aunque he de agradecer a todos y cada uno que leí de este foro, porque todos siempre me aportaron algo.

Otras páginas que me ayudaron a organizarlo y a buscar información sobre su religión, cultura, costumbres, opiniones y demás fueron:
balireincidentes.blogs... /NOVEDADES lo-quinto/ /bali.html aeropuerto nesia/bali Página de turismo de la zona Este de Bali Página en inglés sobre eventos, días festivos y noticias sobre Bali.

También ayudo algunos documentales que vi.
- Callejeros viajeros Bali s/ver/bali
- Españoles por el mundo Bali: undo/bali/

En referencia a la guía, me compré la de Lonely Planet de Indonesia.


Lo primero de todo fue sacar un billete de avión de ida y vuelta desde Bangkok. Después de mucho tiempo mirando y ver que si seguía pasando el tiempo cada vez subía más, decidimos comprarlo con Air Asia, con lo que ya no nos podíamos echar atrás.

El tema de gastos lo pondré al final de cada etapa.


Para las vacunas pedimos hora en el centro de vacunación internacional de nuestra ciudad. Podéis buscarlo aquí según la ciudad en la que estéis. osvacu.htm
Las vacunas no son obligatorias, pero las que nos recomendaron fueron:
- Tétanos/Difteria (ya la teníamos puesta)
- Hepatitis A (esta me la pinché yo misma, ¡hay que ver que valiente soy!, estuve media hora mirando la dichosa agujita y pensando “yo puedo, yo puedo, yo puedo” )
- Hepatitis B (puesta también de antes, un pinchacito menos)
- Fiebre tifoidea
Además de esto, nos recetaron un montón de cosas:
- Fortasec para las diarreas
- Motilium en pastillas (que así pesa menos)
- Paracetamol, Aspirinas, Ibuprofeno, Nolotil para diferentes dolores.
- Augmentine
- Benerva (supuestamente hace que los mosquitos te ataquen menos, aunque hay discusión sobre el tema)
- Suero oral
- .......

En definitiva llevábamos tantas pastillitas que tenía miedo de que me pararan en el aeropuerto, que nosotros y con nuestro ingles macarrónico, haber como les explicábamos para que era todo aquello


El pasaporte tiene que tener vigencia de 6 meses en el momento en que entras al país.
El visado lo sacas directamente en el aeropuerto de Bali, cuesta 25 dólares y sirve para 30 días de estancia. También se puede pagar en euros. Hay gente que dice que equivale 1 dólar-1 euro. Cuando yo fui, no era así. Allí mismo tenían unas pizarras en donde te ponían lo que tenías que pagar si llevabas euros, incluso aceptaban otras monedas; y la conversión aunque no es de las mejores no es 1 dólar -1 euro.
Más información sobre visados, la podéis encontrar en: onsulares/
Con referencia a las tasas de aeropuerto, hay que guardar dinero al final del viaje, ya que al salir del país te cobran 150000 rupias.


Nosotros aquí no nos sacamos ninguno, ya que muchas tarjetas de crédito ofrecen esos seguros. Hace tiempo que ya me saqué unas tarjetas que son gratuitas y que te cubren con bastante dinero, además de veinte mil cosas más, y lo bueno que no hace falta que pagues con ellas el billete. Te cubren por el simple hecho de tenerlas. Ojo que si quieres que te cubran perdida de maletas, retrasos y demás si que hay que pagar con ellas, pero para el seguro médico no. Las que yo tengo son la de “Obsidiana Bankinter” y la de “Citibank”.


Nosotros no nos solemos gastar mucho en alojamiento, nos conformamos con algo que este limpio y barato. Preferimos gastar dinero en otras cosas antes que alojamientos en donde solo vamos a dormir. Aunque al final si que nos dimos algún lujito.
Esa parte fue fácil, estuve enviando unos cuantos mails, ¡con regateo incluido! Bueno, no regateo exactamente, sino que como no les volvías a contestar, ellos te mandaban mails diciendo que bajaban el precio. De hecho cuando fuimos, vimos la lista que tenía el dueño del bungalow y vimos que a cada persona le ponía un precio. Esto nos paso tanto en Ubud como en Lovina.
- En Ubud nos quedamos en Warji House1 durante 3 noches, y nos gustó bastante. ouse1.html
El precio que pone en su página es orientativo, porque a nosotros nos lo dejaron más barato. Además no te piden ningún tipo de tarjeta, solo que avises si no vas a ir.
- En Lovina nos quedamos en “gede Homestay bungalow”. Me encantó, es un bungalow a pie de playa, además los dueños son encantadores. Aquí lo mismo, no te piden tarjetas y pagas directamente allí.

Aprovechando que los alojamientos eran baratos, queríamos darnos un caprichito e ir a alguno tipo Alam Shanti, pero tras buscar y buscar, na de na, no tenían para esos días. Y en algunos sitios que si había nos parecía un poco carillo para nuestro presupuesto, así que, cuando casi ya habíamos desistido, encontramos un pedazo bungalow con piscina propia bastante baratito y a por ello que fuimos. Se llama “Alas Petulu Cottage” y era una pool villa en toda regla. ool-villa/.

Comentar que una semana antes de marchar a Bali, le mande a cada uno de ellos un mail para volver a confirmar la habitación y el precio.

En un principio teníamos contratado un coche con conductor porque mucha gente no recomendaba conducir en Bali; aunque la idea de compartir vacaciones con un desconocido nos chocaba un poco, ya que había leído de experiencias buenas, pero también de experiencias malas como que al final te llevaban donde ellos querían y no lo acordado…
Pero al final y tras ver varios documentales de viajes en Bali y de ver algunos videos en youtube, mi queridísimo novio dijo “yo conduzco, no creo que sea tan difícil”. Así que al final… simplemente… alquilamos un coche.
Que decir de la conducción en Bali, uuuuffffffff
. Yo no podría, no tanto por las curvas y el mal estado de algunas carreteras que de esas hay bastante donde vivo y estoy acostumbrada; sino porque conducen de una forma bastante temeraria sobre todo las motos. Pero mi novio sin problemas, de hecho le encantó conducir allí, a él le pareció divertido porque dice que nunca se aburría en la carretera. “No tienes que ir con miedo, tu eres un coche, ellos son motos, y si te ven decidido ellos te respetan para que tu pases, porque de otra manera se te meten cada 2 por 3 en mitad de la carretera”. Así que si se animan a conducir hay que ir sin miedo, decidido, precavido y con mil ojos. Yoooooo ni en sueños lo intentaría, pero los que estén algo acostumbrados a conducir… ¿quizás?
De hecho fue bastante risa porque los balineses al ver conducir a Dani se quedaban asombrados, y ya no digamos los otros turistas, que cuando veían que él iba a conducir decían
“¡¡¡¡guuuuuaaaaaaauuuuuuuu que valiente!!!!”

Bueno, a lo que íbamos, el coche lo contratamos con
Tenía franquicia de 500000 rupias en caso de accidente (aunque no nos pidió ni tarjeta, ni nada, ni siquiera al llegar allí) y el third party era de 5000000 de rupias.
Por último decir que para conducir en Bali tanto si se alquila motos como coches hay que sacarse el Carnet Internacional de Conducir. Para ello se va a la jefatura de tráfico con una foto y algo de dinero y te lo dan en el acto.


Aquí lo típico:
- Mandar mails con pasaporte a nosotros mismos, por si lo perdíamos (que ya nos paso una vez en Praga, y si no tienes copias es más rollo, así que en todos los viajes lo hacemos)
- Copiar teléfonos importantes de pérdidas de tarjetas y demás.
- Saber donde esta la embajada en Bali por si acaso y teléfonos de emergencia. Aquí tenéis más información: nesia.aspx


El la preparación del viaje, realmente solo gasté en medicinas, que ni me acuerdo de cuanto fue y el billete de avión, ya que lo demás lo pagábamos directamente allí.

- Billete de avión ida y vuelta Bangkok-Denpasar: 5195 baths/persona (120 euros)

Los hoteles y demás (precio para 2 personas):
- Warji House 1 Bungalow: 150000 rupias por día con desayuno
- Gede Homestay Bungalow: 150000 rupias por día con desayuno
- Alas Petulu Cottage en la pool villa: 85 dólares ó 60 euros por día con desayuno y piscina para nosotros solitos.
- Alquiler de coche por 6 días: 1080000 rupias los 6 días. Un Xenia bastante majo.


- Si no os funciona algún vínculo, copiarlo y pegarlo a la página de Google.
- En el comienzo de cada día pongo “ITINERARIO PREVISTO”, pero no significa que lo hayamos hecho tal cual, solo es el que pensábamos hacer, pero luego ocurren miles de cosas y se va improvisando sobre la marcha.
- Al final del diario hay unos enlaces para descargar una recopilación que hice sobre Bali desde historia, religión hasta restaurantes y spas.


Localización: Indonesia Indonesia
    Etapa:  ALGUNOS DATOS DE BALI      


Son 6 horas más que en la península y añádale 1 hora más para Canarias en horario de verano. En Indonesia no hay cambio de hora, así que en horario de invierno hay que sumarle 1 hora a todo lo dicho.


La mismita que en España. Las clavijas de los enchufes también son iguales a los de aquí ó de 3 clavijas, pero sin ningún tipo de adaptador lo utilizábamos sin problemas.


- Si se llama desde España a Bali: 0062+ 361+ el teléfono al que quieras llamar.
- Si se llama desde Bali a España: 001+34+ el teléfono al que quieras llamar.


La moneda es la rupia indonesa. Su valor ahora mismo ronda 1 euro-12200 rp +/-
- Las monedas son de 50, 100, 200, 500, 1000; aunque de éstas, las que más utilizamos son las de 500 y 1000, las otras yo creo que ni las vi. De hecho si compras en supermercados y te tienen que devolver alguna de estas monedas, en vez de dártelas te dan caramelos.
- Los billetes son de 1000, 2000, 5000, 10000, 20000, 50000 y 100000 y muchos de ellos son sábanas de grandes, así que viene bien tener una cartera bieeeen grande.


- Las tarjetas hay muchos sitios que no las aceptan, por lo menos en muchos sitios baratillos a los que íbamos no aceptaban, incluido los bungalows en los que estuvimos. En los sitios un poquillo más lujosos sin problema.
- Los cajeros hay en las ciudades grandes, pero en los pequeños pueblos yo no vi ninguno.
Otro problema de los cajeros es que no te deja sacar mucha cantidad de rupias, por lo que según la tarjeta que se tenga, te chupan bastante en comisiones (por lo menos la mía cada vez que sacas tiene un gasto mínimo). El problema es que en la mayoría de cajeros lo máximo que dejan sacar son entre 1000000 rp hasta 2500000 rp, que así visto parece un montón, pero son unos 140 euros.


• “Ir a un cambio oficial, no a puestecillos en sitios escondidos. En la casa de cambio tiene que haber un cartel con todas las cantidades de los cambios y un cuadrado azul con una numeración que da a entender que es un establecimiento autorizado por el banco de Indonesia. Además, junto a ese letrero debe aparecer una leyenda que diga NO COMISSION”
• "Exigid contar los billetes delante de ellos, después de que ellos lo hayan contado. Como veáis que comienzan a hacer montones de 20 rupias detrás de un mostrador, puede ser un timo.”
• "Los billetes que estén nuevos y no rotos.”
• “Cambiar cantidades redondas (Ej. 100 €).”
• “Usar vuestras calculadoras, dicen que a veces la de ellos pueden estar trucadas.”
• “Cuidado con los billetes de 10000rp que se parecen al de 100000rp”

Bueno, tras toda esta parrafada……


Localización: Indonesia Indonesia
31 DE MAYO DEL 2011


¡¡¡POR FIN!!!
Llega el día en que nos íbamos a Bali. Habíamos llegado el día anterior a Bangkok, y ese día nos levantamos super temprano, ya que el avión salía a las 06:15.
Nos levantamos, recogimos las maletas y bajamos a recepción que allí nos esperaba el coche para llevarnos al aeropuerto.
En Bangkok habíamos pillado uno de esos hoteles cercanos al aeropuerto que te traen y te llevan al mismo y así evitarnos de complicaciones.

Facturamos en Air Asia sin ningún problema. Pasamos el control de pasaporte rapidito y para el avión que vamos. Nos queda solo 4 HORAS de vuelo. Bueno, después de que 2 días antes volásemos Las Palmas-Madrid-Zurich-Bangkok

El vuelo se nos paso rapidísimo, además el paisaje desde la ventanilla es una maravilla; vamos viendo algunas islas de Indonesia con unos volcanes increíbles (lástima que no sacásemos ninguna foto pero estábamos medio dormidos, medio despiertos y ni lo pensamos).

Por fin llegamos a Bali a las 12 (con algo de retraso), pagamos el visado (25 dólares), luego pasamos el control de pasaporte y a buscar las maletas. Aquí un consejo que me sirvió bastante al haberlo leído en los foros. Al lado de la cinta de las maletas hay un montón de gente uniformada que te quieren coger las maletas; si no queréis pagar no les dejéis porque es un servicio que no es del aeropuerto y luego hay que pagarlo.
Luego sacamos dinero en un cajero.
Guuuuuaaaauuuuuu somos millonarios. ¡¡¡Que pedazos billetes!!!

Salimos fuera y allí estaba el hombre de la empresa de rent a car con su cartelito. Nos vamos con él, nos enseña el coche, nos da los papeles, el seguro y demás papeleos, le pagamos y………. EMPIEZA LA AVENTURA.

Después de que se fuera el hombre, estuvimos un rato más en el parking mirando las cosas del coche. El coche estaba genial un Daihatsu Xenia bastante completito, tenia hasta mp3 (cosa rara si alquilas un coche barato, porque casi todos vienen con cassette ¿me pregunto dónde estarán mis cintas?).
Programamos a nuestro amigo GPS y nos vamos a JIMBARAN a comer que nos apretaba el hambre.

Justo a la salida del aeropuerto, primer contratiempo, nos paran en el control de salida y nos dice que tenemos que pagar el parking del aeropuerto. Nos quedamos un poco mosqueados, ya que no nos habían dicho nada,
pero bueno, pagamos y a seguir.

El camino hasta MUAYA BEACH EN JIMBARAN nos pareció espectacular. Se notaba que estábamos en un país totalmente diferente a otros sitios en los que habíamos estado. No parábamos de decir, “mira esto, mira aquello, guuuuaaauuuu, que pasada”. Allí la carretera es un caos; sirve para los coches, las motos (sobretodo de ellas), la gente, los animales; vamos que tenias que tener algo de cuidadin y no despistarse. Se veían motos que llevaban hasta 4 personas allí montados. A los lados de la carretera estaba llena de casas en donde la gente hacia vida fuera, se veía a mujeres preparando ofrendas, lavando la ropa, a niños jugando, hombres conversando, un montón de Warung (bares sencillos al aire libre), tiendas al aire libre,…vamos era algo flipante. Todo esto era como una mezcla extraña, ya que por un lado nos parecía bastante descuidado y sucio, pero por otro lado todo tenía un montón de colorido y alegría; y además, por todos los sitios y por todos lados estaba llena de ofrendas que preparan sobre hojas de plátano y le ponen comida, frutas, incienso, galletas, flores… (Este tipo de ofrendas se llaman canang sari y las vimos por toda la isla)
Al parecer las ofrendas en muy importante para su religión, lo hacen mínimo 3 veces al día, y los ponen en los coches, en la entrada a la casa, en la entrada de su negocio, en los templos, en los arrozales…, en definitiva, por todos lados. Y por lo que nos dijeron se dedican tanto a los dioses buenos como a los malos para que no se enfaden.
Otra cosa curiosa es que estaba lleno de puestos al aire libre donde te vendían botellas de gasolina.

Vida en Bali, el tráfico de las motos. Fíjense como va la mujer en la moto vestida para una ceremonia.

Más motos con personas de todas las edades.

Éstas son las ofrendas CANANG SARI que estaban por todas partes.

Pasando por los diferentes pueblos.

En la primera foto se ve una típica tienda de las que estaban por los laterales de la carretera. En la otra foto realizaban artesania con la madera. Fíjense como está amontonada.

Por fin y después de tanto asombro, llegamos a MUAYA BEACH. Esto es una zona en donde hay un montón de restaurantes de mariscos a pie de playa.
Nos decidimos por el restaurante Nyoman, ya que lo habíamos visto recomendado en varios sitios. Al principio nos quedamos mosqueados porque la entrada no se parecía nada a lo que habían descrito algunos en el foro, más bien parecía una pescadería de mercado; pero, claro…., solo habíamos visto la entrada, pero al pasar
¡¡¡QUE MARAVILLA!!! Tenían todas las mesas con vistas a la playa, incluso las últimas mesas estaban sobre la arena.

Restaurante Nyoman

Por supuesto nos fuimos a las que estaban en la arena y a comer que había mucha hambre.
Pedimos unas gambas enormes y unas almejas con una salsa de la casa que estaban de vicio. Además por cuenta de la casa te traen sopa, un montón de arroz, unas verduras que eran como unas algas que estaban uuuummmmm y un montón de salsas, algunas picantes, otras no tanto. Y por supuesto nuestro primer coco natural.
Y allí, tranquilamente descalzos, con los pies en la arena y disfrutando del sonido del mar nos dimos nuestro primer festín en Bali.

Menuda pinta tenía la comida y estaba aun más riiiiica.

Y para mayor disfrute vinieron unos cuantos hombres con la guitarra y se nos pusieron a cantar “Corazón Espinado” de Santana.
¡¡Yo no me lo creía!! estaba en Bali y me cantaban eso y yo contentísima cantando con ellos.

Después de comer estuvimos paseando y remojándonos un rato por la playa de Muaya. En realidad esta playa es una parte de la playa de Jimbaran que se encuentra al sur del aeropuerto. Es una playa bastante larga y tranquila, sin abarrotamientos, o por lo menos ese día había muy poca gente en la playa.

Tranquilidad en la playa

Tras el paseo nos fuimos a nuestro siguiente destino: LA PLAYA DE PADANG PADANG.
En esta playa se realizan todos los años los campeonatos internacionales de surf patrocinados por Rip Curl.

Es una playa bastante pequeña, yo la definiría como una cala. En la playa había bastante gente para lo pequeña que era. La verdad, esta playa para mi gusto no es nada del otro mundo, a no ser que te guste el surf. Una cosa curiosa de esta playa es que había un arroyo que desembocaba en el mar.

Surf en Padang Padang

Ya habíamos leído que Bali no tenía buenas playas, pero pensaba que iban a ser mejores de lo que vimos. A lo mejor para alguien que viva lejos del mar le puede parecer bonita, pero nosotros que vivimos en una isla pues…. bastante normalitas.
Pero bueno, tampoco nos importo, no fuimos a Bali a ver exclusivamente sus playas, de hecho solo el día de hoy estaba dedicado a ver las playas (ya que sabíamos que tras tanto avión íbamos a estar algo cansados). Los demás días eran para recorrer la isla.


Etapas 1 a 3,  total 13
 1  2  3  ..  5  siguiente siguiente

Votaciones al diario
  Puntos Votos Media
Mes actual 0 0
Mes anterior 0 0
Total 159 32
0 Votos
0 Votos
0 Votos
0 Votos
0 Votos
Para votar este diario debe registrarse como usuario

Registrate AQUÍ
Visitas mes anterior: 1025 Visitas mes actual: 926 Total visitas: 67930

  Últimos comentarios al diario  ESCAPADA DE 6 DIAS A BALI (JUNIO 2011)
Total comentarios 41  Visualizar todos los comentarios

martuxi78  martuxi78  06/08/2013 23:36   

koala66  koala66  15/09/2013 11:39   
Que buen diario, con tanta información y vivencias!!!
Gracias por compartirlo, me será de utilidad!

martuxi78  martuxi78  15/09/2013 19:32   
Gracias Koala66, han pasado un par de añitos, pero me alegro de que te sea util Guiño

anshaky  anshaky  01/08/2015 18:43   
Comentario sobre la etapa: ADIÓS A BALI, CONSEJOS Y DESPEDIDAS
Gracias por la ayuda! Creo que nos servira muchisimo tu diario! Guiño

venecia1  venecia1  27/03/2016 19:33   
Te dejo mis estrellitas, me ha gustado mucho

Visualizar todos los comentarios >>

Registrate AQUÍ

Foros de Viajes
Information Tema: Qué Visitar en Bali: Dudas generales, Itinerarios- Indonesia
Foro Sudeste Asiático Foro Sudeste Asiático: Vietnam, Camboya, Laos, Myanmar, Indonesia, Malasia, Filipinas... y resto de Sudeste Asiático excepto Thailandia
Ultimos 5 Mensajes de 632
719853 Lecturas
Travel Adict
Travel Adict
Ago 06, 2011
Mensajes: 80

Fecha: Sab Jul 22, 2017 03:49 pm    Título: Re: Qué Visitar en Bali: Dudas generales, Itinerarios-...

Aupa gente! Os escribo desde Ubud y os cuento algunas cosillas que puede que se hayan dicho por aquí, pero por si acaso... Parece que hace unos meses han subido los precios de todos los Templos. Nosotros el primero que visitamos fu el Batur, 35000 y nos compramos un sarong x50000 pensando que nos valdría para todos. El siguiente al que fuimos fué Besakih, 60000 pp!! Eso si, ya incluyen guía y alquiler de Sarong (cagada...) En Tirta Empul nos colamos sin darnos cuenta, hay dos carreteras, por abajo vas al parking y por arriba hay un parking con motos (de locales) y una barrera para coches,...  Leer más ...
Willy Fog
Willy Fog
Sep 07, 2010
Mensajes: 22957

Fecha: Sab Jul 22, 2017 08:22 pm    Título: Re: Qué Visitar en Bali: Dudas generales, Itinerarios-...

Vaya... Trist
Super Expert
Super Expert
Ene 29, 2012
Mensajes: 354

Fecha: Dom Jul 23, 2017 09:29 am    Título: Re: Qué Visitar en Bali: Dudas generales, Itinerarios-...

Gracias por compartir la información! Yo todavía me pierdo con esas cantidades Riendo
Travel Adict
Travel Adict
Ago 06, 2011
Mensajes: 80

Fecha: Dom Jul 23, 2017 03:51 pm    Título: Re: Qué Visitar en Bali: Dudas generales, Itinerarios-...

Actualizo: Tanah Lot 60000 pp, no hace falta sarong Taman Ayun 20000 pp El mejor cambio de lo que llevamos en indonesia (Java, Borneo y Bali) es en la calle principal de Ubud, ahora mismo a 15400 idr por Euro. Por cierto, en Bali hemos hecho todo con moto. Se hace un poco duro, pero se puede hacer perfectamente, mas rápido que en coche por los atascos, pero menos cómodo... Ojo, en las zonas altas (bratan y batur), para la moto llevar por lo menos algo tipo sudadera, que hace freskete. También os digo que yo uso moto en España, para alguien que no haya usado nunca entiendo que los...  Leer más ...
Silver Traveller
Silver Traveller
Jun 13, 2016
Mensajes: 21

Fecha: Lun Jul 24, 2017 02:47 pm    Título: Re: Qué Visitar en Bali: Dudas generales, Itinerarios-...

Hola a todos. En agosto vamos 2 personas a Indonesia y pasamos 4-5 días en Bali. Había pensado en repartir 2 días en UBUD y 2 en KUTA (en ese orden). El quinto día es el volamos por la tarde por lo que la idea es acabar en Kuta que está más cerca del aeropuerto de Denpasar. En UBUD he visto que lo más turístico es el Monkey Forest, que iríamos el segundo día, pero querríamos aprovechar el día que llegamos por la mañana para ver algunos templos o algo así. En KUTA, el primer día lo dedicaríamos al turismo (templo Luhur Uluwatu) y alguna playa que quede cerca. El segundo día iriamos...  Leer más ...
Respuesta Rápida en el Foro
Registrate AQUÍ

All the content and photo-galleries in this Portal are property of or our Users., and is the same Portal.
Aviso Legal - Publicidad - Nosotros en Redes Sociales: Pag. de Google + Pag. de Facebook Twitter - Política de Privacidad