Mostrar/Ocultar
Mostrar/Ocultar Blogs / Diarios
Mostrar/Ocultar Fotos / Pics
Mostrar/Ocultar Ads
ESCAPADA DE 6 DIAS A BALI (JUNIO 2011) ūüß≠ Blogs de Indonesia
Indice
Indice
M√°s leidos
M√°s leidos
√öltimos Diarios
√öltimos Diarios
M√°s Votados
M√°s Votados
Diarios por paises
Diarios por paises
Ayuda
Ayuda

Compartir enlaces Compartir enlaces

 
 
Enlace:    Corto  Largo
Copia el texto de uno de los cajones para compartir el enlace


Diario: ESCAPADA DE 6 DIAS A BALI (JUNIO 2011)  -  Localizaci√≥n:  Indonesia  Indonesia
Descripci√≥n: Informaci√≥n y experiencias de un viaje a Bali en junio del 2011, organizado totalmente por libre.
Autor: Martuxi78   Fecha creaci√≥n: 
Compartir: 
Compartir:


Etapas 1 a 3,  total 13
 1  2  3  ..  5  siguiente siguiente



Etapa: ANTES DEL VIAJE: INFORMACI√ďN Y PREPARATIVOS  -  Localizaci√≥n:  Indonesia Indonesia
Fecha creaci√≥n: 29/08/2011 15:06  
Compartir: 
Compartir:
Por fin me he decidido a escribir mi primer diario, no se como saldrá pero espero que os pueda servir de ayuda para futuros viajeros ó al menos que disfrutéis leyéndolo, aunque sea un poquito.

Este viaje a Bali fue nuestro primer contacto con Asia y lo hicimos como siempre hemos hecho: ir por libre.
Decidimos ir a Bali como una prolongaci√≥n del viaje a Tailandia. Sustituimos el sur de Tailandia (ya que pensamos ir con unos amigos el pr√≥ximo a√Īo) y nos hicimos una escapadita a Bali de 6 d√≠as.

Lo primero fue los preparativos del viaje; para esto me ayudo mucho este foro, que es una auténtica maravilla. Los diarios del foro de donde saqué más información fueron:
www.losviajeros.com/Bl... php?b=1760 De Vecogu
www.losviajeros.com/Bl... php?b=1441 De monica31
Aunque he de agradecer a todos y cada uno que leí de este foro, porque todos siempre me aportaron algo.

Otras páginas que me ayudaron a organizarlo y a buscar información sobre su religión, cultura, costumbres, opiniones y demás fueron:
costrelas1.wordpress.com/en-bali/
balireincidentes.blogs... /NOVEDADES
www.elrincondesele.com... lo-quinto/
diariodeunviaje.com/bali.html
ancobo.blogspot.com/20... /bali.html
www.viajeros.com/diari... aeropuerto
vivirenbali.blogspot.com/
www.visionbali.com/sp/cultura.htm
www.isladebali.com/
www.minube.com/viajes/... nesia/bali
embajadaindonesia.es/
www.karangasemtourism.com/ P√°gina de turismo de la zona Este de Bali
www.balicalendar.com/ Página en inglés sobre eventos, días festivos y noticias sobre Bali.

También ayudo algunos documentales que vi.
- Callejeros viajeros Bali
play.cuatro.com/direct... s/ver/bali
- Espa√Īoles por el mundo Bali:
www.rtve.es/television... undo/bali/

En referencia a la guía, me compré la de Lonely Planet de Indonesia.


BILLETES


Lo primero de todo fue sacar un billete de avión de ida y vuelta desde Bangkok. Después de mucho tiempo mirando y ver que si seguía pasando el tiempo cada vez subía más, decidimos comprarlo con Air Asia, con lo que ya no nos podíamos echar atrás. www.airasia.com/my/en/home.html

El tema de gastos lo pondré al final de cada etapa.


VACUNAS Y BOTIQU√ćN


Para las vacunas pedimos hora en el centro de vacunaci√≥n internacional de nuestra ciudad. Pod√©is buscarlo aqu√≠ seg√ļn la ciudad en la que est√©is.
www.msc.es/profesional... osvacu.htm
Las vacunas no son obligatorias, pero las que nos recomendaron fueron:
- Tétanos/Difteria (ya la teníamos puesta)
- Hepatitis A (esta me la pinch√© yo misma, ¬°hay que ver que valiente soy!, estuve media hora mirando la dichosa agujita y pensando ‚Äúyo puedo, yo puedo, yo puedo‚ÄĚ )
- Hepatitis B (puesta también de antes, un pinchacito menos)
- Fiebre tifoidea
Además de esto, nos recetaron un montón de cosas:
- Fortasec para las diarreas
- Motilium en pastillas (que así pesa menos)
- Paracetamol, Aspirinas, Ibuprofeno, Nolotil para diferentes dolores.
- Augmentine
- Benerva (supuestamente hace que los mosquitos te ataquen menos, aunque hay discusión sobre el tema)
- Suero oral
- .......

En definitiva llevábamos tantas pastillitas que tenía miedo de que me pararan en el aeropuerto, que nosotros y con nuestro ingles macarrónico, haber como les explicábamos para que era todo aquello


VISADOS, PASAPORTE Y TASAS DE AEROPUERTO

El pasaporte tiene que tener vigencia de 6 meses en el momento en que entras al país.
El visado lo sacas directamente en el aeropuerto de Bali, cuesta 25 dólares y sirve para 30 días de estancia. También se puede pagar en euros. Hay gente que dice que equivale 1 dólar-1 euro. Cuando yo fui, no era así. Allí mismo tenían unas pizarras en donde te ponían lo que tenías que pagar si llevabas euros, incluso aceptaban otras monedas; y la conversión aunque no es de las mejores no es 1 dólar -1 euro.
Más información sobre visados, la podéis encontrar en:
embajadaindonesia.es/c... onsulares/
Con referencia a las tasas de aeropuerto, hay que guardar dinero al final del viaje, ya que al salir del país te cobran 150000 rupias.


SEGURO M√ČDICO

Nosotros aqu√≠ no nos sacamos ninguno, ya que muchas tarjetas de cr√©dito ofrecen esos seguros. Hace tiempo que ya me saqu√© unas tarjetas que son gratuitas y que te cubren con bastante dinero, adem√°s de veinte mil cosas m√°s, y lo bueno que no hace falta que pagues con ellas el billete. Te cubren por el simple hecho de tenerlas. Ojo que si quieres que te cubran perdida de maletas, retrasos y dem√°s si que hay que pagar con ellas, pero para el seguro m√©dico no. Las que yo tengo son la de ‚ÄúObsidiana Bankinter‚ÄĚ y la de ‚ÄúCitibank‚ÄĚ.

ALOJAMIENTO


Nosotros no nos solemos gastar mucho en alojamiento, nos conformamos con algo que este limpio y barato. Preferimos gastar dinero en otras cosas antes que alojamientos en donde solo vamos a dormir. Aunque al final si que nos dimos alg√ļn lujito.
Esa parte fue f√°cil, estuve enviando unos cuantos mails, ¬°con regateo incluido! Bueno, no regateo exactamente, sino que como no les volv√≠as a contestar, ellos te mandaban mails diciendo que bajaban el precio. De hecho cuando fuimos, vimos la lista que ten√≠a el due√Īo del bungalow y vimos que a cada persona le pon√≠a un precio. Esto nos paso tanto en Ubud como en Lovina.
- En Ubud nos quedamos en Warji House1 durante 3 noches, y nos gustó bastante. www.warjibungalow.com/... ouse1.html
El precio que pone en su p√°gina es orientativo, porque a nosotros nos lo dejaron m√°s barato. Adem√°s no te piden ning√ļn tipo de tarjeta, solo que avises si no vas a ir.
- En Lovina nos quedamos en ‚Äúgede Homestay bungalow‚ÄĚ. Me encant√≥, es un bungalow a pie de playa, adem√°s los due√Īos son encantadores. www.gedehomestay.com/ Aqu√≠ lo mismo, no te piden tarjetas y pagas directamente all√≠.

Aprovechando que los alojamientos eran baratos, quer√≠amos darnos un caprichito e ir a alguno tipo Alam Shanti, pero tras buscar y buscar, na de na, no ten√≠an para esos d√≠as. Y en algunos sitios que si hab√≠a nos parec√≠a un poco carillo para nuestro presupuesto, as√≠ que, cuando casi ya hab√≠amos desistido, encontramos un pedazo bungalow con piscina propia bastante baratito y a por ello que fuimos. Se llama ‚ÄúAlas Petulu Cottage‚ÄĚ y era una pool villa en toda regla. alaspetulu.com/room-fa... ool-villa/.


Comentar que una semana antes de marchar a Bali, le mande a cada uno de ellos un mail para volver a confirmar la habitación y el precio.


COCHE DE ALQUILER
En un principio teníamos contratado un coche con conductor porque mucha gente no recomendaba conducir en Bali; aunque la idea de compartir vacaciones con un desconocido nos chocaba un poco, ya que había leído de experiencias buenas, pero también de experiencias malas como que al final te llevaban donde ellos querían y no lo acordado…
Pero al final y tras ver varios documentales de viajes en Bali y de ver algunos videos en youtube, mi querid√≠simo novio dijo ‚Äúyo conduzco, no creo que sea tan dif√≠cil‚ÄĚ. As√≠ que al final‚Ķ simplemente‚Ķ alquilamos un coche.
Que decir de la conducción en Bali, uuuuffffffff
. Yo no podr√≠a, no tanto por las curvas y el mal estado de algunas carreteras que de esas hay bastante donde vivo y estoy acostumbrada; sino porque conducen de una forma bastante temeraria sobre todo las motos. Pero mi novio sin problemas, de hecho le encant√≥ conducir all√≠, a √©l le pareci√≥ divertido porque dice que nunca se aburr√≠a en la carretera. ‚ÄúNo tienes que ir con miedo, tu eres un coche, ellos son motos, y si te ven decidido ellos te respetan para que tu pases, porque de otra manera se te meten cada 2 por 3 en mitad de la carretera‚ÄĚ. As√≠ que si se animan a conducir hay que ir sin miedo, decidido, precavido y con mil ojos. Yoooooo ni en sue√Īos lo intentar√≠a, pero los que est√©n algo acostumbrados a conducir‚Ķ ¬Ņquiz√°s?
De hecho fue bastante risa porque los balineses al ver conducir a Dani se quedaban asombrados, y ya no digamos los otros turistas, que cuando veían que él iba a conducir decían
‚Äú¬°¬°¬°¬°guuuuuaaaaaaauuuuuuuu que valiente!!!!‚ÄĚ

Bueno, a lo que íbamos, el coche lo contratamos con www.sesehbali.com/
Tenía franquicia de 500000 rupias en caso de accidente (aunque no nos pidió ni tarjeta, ni nada, ni siquiera al llegar allí) y el third party era de 5000000 de rupias.
Por √ļltimo decir que para conducir en Bali tanto si se alquila motos como coches hay que sacarse el Carnet Internacional de Conducir. Para ello se va a la jefatura de tr√°fico con una foto y algo de dinero y te lo dan en el acto.


OTROS PREPARATIVOS

Aquí lo típico:
- Mandar mails con pasaporte a nosotros mismos, por si lo perdíamos (que ya nos paso una vez en Praga, y si no tienes copias es más rollo, así que en todos los viajes lo hacemos)
- Copiar teléfonos importantes de pérdidas de tarjetas y demás.
- Saber donde esta la embajada en Bali por si acaso y teléfonos de emergencia. Aquí tenéis más información:
www.maec.es/es/MenuPpa... nesia.aspx


GASTOS


El la preparación del viaje, realmente solo gasté en medicinas, que ni me acuerdo de cuanto fue y el billete de avión, ya que lo demás lo pagábamos directamente allí.

- Billete de avión ida y vuelta Bangkok-Denpasar: 5195 baths/persona (120 euros)

Los hoteles y dem√°s (precio para 2 personas):
- Warji House 1 Bungalow: 150000 rupias por día con desayuno
- Gede Homestay Bungalow: 150000 rupias por día con desayuno
- Alas Petulu Cottage en la pool villa: 85 dólares ó 60 euros por día con desayuno y piscina para nosotros solitos.
- Alquiler de coche por 6 días: 1080000 rupias los 6 días. Un Xenia bastante majo.



NOTAS:

- Si no os funciona alg√ļn v√≠nculo, copiarlo y pegarlo a la p√°gina de Google.
- En el comienzo de cada d√≠a pongo ‚ÄúITINERARIO PREVISTO‚ÄĚ, pero no significa que lo hayamos hecho tal cual, solo es el que pens√°bamos hacer, pero luego ocurren miles de cosas y se va improvisando sobre la marcha.
- Al final del diario hay unos enlaces para descargar una recopilación que hice sobre Bali desde historia, religión hasta restaurantes y spas.





Volver arriba
Compartir:


Ver Etapa: ANTES DEL VIAJE: INFORMACI√ďN Y PREPARATIVOS



Etapa: ALGUNOS DATOS DE BALI  -  Localizaci√≥n:  Indonesia Indonesia
Fecha creaci√≥n: 29/08/2011 19:23  
Compartir: 
Compartir:

DIFERENCIA HORARIA:


Son 6 horas m√°s que en la pen√≠nsula y a√Ī√°dale 1 hora m√°s para Canarias en horario de verano. En Indonesia no hay cambio de hora, as√≠ que en horario de invierno hay que sumarle 1 hora a todo lo dicho.

ELECTRICIDAD:


La mismita que en Espa√Īa. Las clavijas de los enchufes tambi√©n son iguales a los de aqu√≠ √≥ de 3 clavijas, pero sin ning√ļn tipo de adaptador lo utiliz√°bamos sin problemas.

¬ŅCOMO LLAMAR POR TELEFONO?:


- Si se llama desde Espa√Īa a Bali: 0062+ 361+ el tel√©fono al que quieras llamar.
- Si se llama desde Bali a Espa√Īa: 001+34+ el tel√©fono al que quieras llamar.


MONEDA:


La moneda es la rupia indonesa. Su valor ahora mismo ronda 1 euro-12200 rp +/-
- Las monedas son de 50, 100, 200, 500, 1000; aunque de éstas, las que más utilizamos son las de 500 y 1000, las otras yo creo que ni las vi. De hecho si compras en supermercados y te tienen que devolver alguna de estas monedas, en vez de dártelas te dan caramelos.
- Los billetes son de 1000, 2000, 5000, 10000, 20000, 50000 y 100000 y muchos de ellos son sábanas de grandes, así que viene bien tener una cartera bieeeen grande.


TARJETAS Y CAJEROS:


- Las tarjetas hay muchos sitios que no las aceptan, por lo menos en muchos sitios baratillos a los que íbamos no aceptaban, incluido los bungalows en los que estuvimos. En los sitios un poquillo más lujosos sin problema.
- Los cajeros hay en las ciudades grandes, pero en los peque√Īos pueblos yo no vi ninguno.
Otro problema de los cajeros es que no te deja sacar mucha cantidad de rupias, por lo que seg√ļn la tarjeta que se tenga, te chupan bastante en comisiones (por lo menos la m√≠a cada vez que sacas tiene un gasto m√≠nimo). El problema es que en la mayor√≠a de cajeros lo m√°ximo que dejan sacar son entre 1000000 rp hasta 2500000 rp, que as√≠ visto parece un mont√≥n, pero son unos 140 euros.


‚ÄúCONSEJOS PARA CAMBIAR DINERO:‚ÄĚ

‚ÄĘ ‚ÄúIr a un cambio oficial, no a puestecillos en sitios escondidos. En la casa de cambio tiene que haber un cartel con todas las cantidades de los cambios y un cuadrado azul con una numeraci√≥n que da a entender que es un establecimiento autorizado por el banco de Indonesia. Adem√°s, junto a ese letrero debe aparecer una leyenda que diga NO COMISSION‚ÄĚ
‚ÄĘ "Exigid contar los billetes delante de ellos, despu√©s de que ellos lo hayan contado. Como ve√°is que comienzan a hacer montones de 20 rupias detr√°s de un mostrador, puede ser un timo.‚ÄĚ
‚ÄĘ "Los billetes que est√©n nuevos y no rotos.‚ÄĚ
‚ÄĘ ‚ÄúCambiar cantidades redondas (Ej. 100 ‚ā¨).‚ÄĚ
‚ÄĘ ‚ÄúUsar vuestras calculadoras, dicen que a veces la de ellos pueden estar trucadas.‚ÄĚ
‚ÄĘ ‚ÄúCuidado con los billetes de 10000rp que se parecen al de 100000rp‚ÄĚ

Bueno, tras toda esta parrafada……







Volver arriba
Compartir:


Ver Etapa: ALGUNOS DATOS DE BALI



Etapa: DE PLAYA EN PLAYA CONDUCIENDO POR EL SUR DE BALI  -  Localizaci√≥n:  Indonesia Indonesia
Fecha creaci√≥n: 29/08/2011 21:45  
Compartir: 
Compartir:
31 DE MAYO DEL 2011


ITINERARIO PREVISTO: AEROPUERTO - ALMORZAR EN JIMBARAN ‚Äď DREAMLAND - PADANG PADANG - PURA LUHUR ULUWATU Y DANZAS - UBUD


¬°¬°¬°POR FIN!!!
Llega el día en que nos íbamos a Bali. Habíamos llegado el día anterior a Bangkok, y ese día nos levantamos super temprano, ya que el avión salía a las 06:15.
Nos levantamos, recogimos las maletas y bajamos a recepción que allí nos esperaba el coche para llevarnos al aeropuerto.
En Bangkok habíamos pillado uno de esos hoteles cercanos al aeropuerto que te traen y te llevan al mismo y así evitarnos de complicaciones.

Facturamos en Air Asia sin ning√ļn problema. Pasamos el control de pasaporte rapidito y para el avi√≥n que vamos. Nos queda solo 4 HORAS de vuelo. Bueno, despu√©s de que 2 d√≠as antes vol√°semos Las Palmas-Madrid-Zurich-Bangkok
¬°¬°¬°ESTO NO ES NADA!!!

El vuelo se nos paso rapidísimo, además el paisaje desde la ventanilla es una maravilla; vamos viendo algunas islas de Indonesia con unos volcanes increíbles (lástima que no sacásemos ninguna foto pero estábamos medio dormidos, medio despiertos y ni lo pensamos).

Por fin llegamos a Bali a las 12 (con algo de retraso), pagamos el visado (25 dólares), luego pasamos el control de pasaporte y a buscar las maletas. Aquí un consejo que me sirvió bastante al haberlo leído en los foros. Al lado de la cinta de las maletas hay un montón de gente uniformada que te quieren coger las maletas; si no queréis pagar no les dejéis porque es un servicio que no es del aeropuerto y luego hay que pagarlo.
Luego sacamos dinero en un cajero.
Guuuuuaaaauuuuuu somos millonarios. ¬°¬°¬°Que pedazos billetes!!!

Salimos fuera y all√≠ estaba el hombre de la empresa de rent a car con su cartelito. Nos vamos con √©l, nos ense√Īa el coche, nos da los papeles, el seguro y dem√°s papeleos, le pagamos y‚Ķ‚Ķ‚Ķ. EMPIEZA LA AVENTURA.

Despu√©s de que se fuera el hombre, estuvimos un rato m√°s en el parking mirando las cosas del coche. El coche estaba genial un Daihatsu Xenia bastante completito, tenia hasta mp3 (cosa rara si alquilas un coche barato, porque casi todos vienen con cassette ¬Ņme pregunto d√≥nde estar√°n mis cintas?).
Programamos a nuestro amigo GPS y nos vamos a JIMBARAN a comer que nos apretaba el hambre.

Justo a la salida del aeropuerto, primer contratiempo, nos paran en el control de salida y nos dice que tenemos que pagar el parking del aeropuerto. Nos quedamos un poco mosqueados, ya que no nos habían dicho nada,
pero bueno, pagamos y a seguir.

El camino hasta MUAYA BEACH EN JIMBARAN nos pareci√≥ espectacular. Se notaba que est√°bamos en un pa√≠s totalmente diferente a otros sitios en los que hab√≠amos estado. No par√°bamos de decir, ‚Äúmira esto, mira aquello, guuuuaaauuuu, que pasada‚ÄĚ. All√≠ la carretera es un caos; sirve para los coches, las motos (sobretodo de ellas), la gente, los animales; vamos que tenias que tener algo de cuidadin y no despistarse. Se ve√≠an motos que llevaban hasta 4 personas all√≠ montados. A los lados de la carretera estaba llena de casas en donde la gente hacia vida fuera, se ve√≠a a mujeres preparando ofrendas, lavando la ropa, a ni√Īos jugando, hombres conversando, un mont√≥n de Warung (bares sencillos al aire libre), tiendas al aire libre,‚Ķvamos era algo flipante. Todo esto era como una mezcla extra√Īa, ya que por un lado nos parec√≠a bastante descuidado y sucio, pero por otro lado todo ten√≠a un mont√≥n de colorido y alegr√≠a; y adem√°s, por todos los sitios y por todos lados estaba llena de ofrendas que preparan sobre hojas de pl√°tano y le ponen comida, frutas, incienso, galletas, flores‚Ķ (Este tipo de ofrendas se llaman canang sari y las vimos por toda la isla)
Al parecer las ofrendas en muy importante para su religión, lo hacen mínimo 3 veces al día, y los ponen en los coches, en la entrada a la casa, en la entrada de su negocio, en los templos, en los arrozales…, en definitiva, por todos lados. Y por lo que nos dijeron se dedican tanto a los dioses buenos como a los malos para que no se enfaden.
Otra cosa curiosa es que estaba lleno de puestos al aire libre donde te vendían botellas de gasolina.



Vida en Bali, el tráfico de las motos. Fíjense como va la mujer en la moto vestida para una ceremonia.


M√°s motos con personas de todas las edades.


√Čstas son las ofrendas CANANG SARI que estaban por todas partes.


Pasando por los diferentes pueblos.


En la primera foto se ve una típica tienda de las que estaban por los laterales de la carretera. En la otra foto realizaban artesania con la madera. Fíjense como está amontonada.


Por fin y después de tanto asombro, llegamos a MUAYA BEACH. Esto es una zona en donde hay un montón de restaurantes de mariscos a pie de playa.
Nos decidimos por el restaurante Nyoman, ya que lo habíamos visto recomendado en varios sitios. Al principio nos quedamos mosqueados porque la entrada no se parecía nada a lo que habían descrito algunos en el foro, más bien parecía una pescadería de mercado; pero, claro…., solo habíamos visto la entrada, pero al pasar
¬°¬°¬°QUE MARAVILLA!!! Ten√≠an todas las mesas con vistas a la playa, incluso las √ļltimas mesas estaban sobre la arena.

Restaurante Nyoman

Por supuesto nos fuimos a las que estaban en la arena y a comer que había mucha hambre.
Pedimos unas gambas enormes y unas almejas con una salsa de la casa que estaban de vicio. Además por cuenta de la casa te traen sopa, un montón de arroz, unas verduras que eran como unas algas que estaban uuuummmmm y un montón de salsas, algunas picantes, otras no tanto. Y por supuesto nuestro primer coco natural.
Y allí, tranquilamente descalzos, con los pies en la arena y disfrutando del sonido del mar nos dimos nuestro primer festín en Bali.

Menuda pinta tenía la comida y estaba aun más riiiiica.


Y para mayor disfrute vinieron unos cuantos hombres con la guitarra y se nos pusieron a cantar ‚ÄúCoraz√≥n Espinado‚ÄĚ de Santana.
¡¡Yo no me lo creía!! estaba en Bali y me cantaban eso y yo contentísima cantando con ellos.

Después de comer estuvimos paseando y remojándonos un rato por la playa de Muaya. En realidad esta playa es una parte de la playa de Jimbaran que se encuentra al sur del aeropuerto. Es una playa bastante larga y tranquila, sin abarrotamientos, o por lo menos ese día había muy poca gente en la playa.

Tranquilidad en la playa

Tras el paseo nos fuimos a nuestro siguiente destino: LA PLAYA DE PADANG PADANG.
En esta playa se realizan todos los a√Īos los campeonatos internacionales de surf patrocinados por Rip Curl.

*** Imagen borrada de Tinypic ***

Es una playa bastante peque√Īa, yo la definir√≠a como una cala. En la playa hab√≠a bastante gente para lo peque√Īa que era. La verdad, esta playa para mi gusto no es nada del otro mundo, a no ser que te guste el surf. Una cosa curiosa de esta playa es que hab√≠a un arroyo que desembocaba en el mar.

Surf en Padang Padang

Ya habíamos leído que Bali no tenía buenas playas, pero pensaba que iban a ser mejores de lo que vimos. A lo mejor para alguien que viva lejos del mar le puede parecer bonita, pero nosotros que vivimos en una isla pues…. bastante normalitas.
Pero bueno, tampoco nos importo, no fuimos a Bali a ver exclusivamente sus playas, de hecho solo el día de hoy estaba dedicado a ver las playas (ya que sabíamos que tras tanto avión íbamos a estar algo cansados). Los demás días eran para recorrer la isla.





Volver arriba
Compartir:


Ver Etapa: DE PLAYA EN PLAYA CONDUCIENDO POR EL SUR DE BALI


Etapas 1 a 3,  total 13
 1  2  3  ..  5  siguiente siguiente



Votaciones al diario
Mes Puntos Votos Media
Actual 0 0
Anterior 0 0
Total 164 33
Votos
0 Votos
0 Votos
0 Votos
0 Votos
0 Votos
Para votar este diario debe registrarse como usuario

Registrate AQU√ć
Visitas mes anterior: 599 Visitas mes actual: 242 Total visitas: 93839

  √öltimos comentarios al diario  ESCAPADA DE 6 DIAS A BALI (JUNIO 2011)
Total comentarios 42  Visualizar todos los comentarios

Koala66  koala66  15/09/2013 11:39   
Que buen diario, con tanta información y vivencias!!!
Gracias por compartirlo, me ser√° de utilidad!

Martuxi78  martuxi78  15/09/2013 19:32   
Gracias Koala66, han pasado un par de a√Īitos, pero me alegro de que te sea util Gui√Īo

Anshaky  anshaky  01/08/2015 18:43   
Comentario sobre la etapa: ADI√ďS A BALI, CONSEJOS Y DESPEDIDAS
Gracias por la ayuda! Creo que nos servira muchisimo tu diario! Gui√Īo

Venecia1  venecia1  27/03/2016 19:33
Te dejo mis estrellitas, me ha gustado mucho

Raiser1969  raiser1969  21/06/2018 21:36
No lo había leído, pero está muy bien, muy currado, felicitaciones y punticos,claro.

Visualizar todos los comentarios >>
CREAR COMENTARIO EN EL DIARIO

Registrate AQU√ć
Volver arriba

Foros de Viajes
Information Tema: Qué Visitar en Bali: Dudas generales, Itinerarios- Indonesia
Foro Sudeste Asi√°tico Foro Sudeste Asi√°tico: Foro del Sudeste Asi√°tico: Vietnam, Indonesia, Camboya, Laos, Myanmar, Malasia, Filipinas... y resto de Sudeste Asi√°tico excepto Tailandia
Ultimos 5 Mensajes de 663
970240 Lecturas
AutorMensaje
jj70
Jj70
Travel Addict
Travel Addict
Ene 13, 2016
Mensajes: 65

Fecha: Jue Sep 24, 2020 09:59 am    T√≠tulo: Re: Qu√© Visitar en Bali: Dudas generales, Itinerarios

Yo tbn tenía pensado ir en octubre. Conoces las gili?. Entre las Gili y las Lembogan, con cual te quedarías?
laredo-viajero
Laredo-viajero
Dr. Livingstone
Dr. Livingstone
May 30, 2007
Mensajes: 5441

Fecha: Jue Sep 24, 2020 07:29 pm    T√≠tulo: Re: Qu√© Visitar en Bali: Dudas generales, Itinerarios

Nosotros ahora tendr√≠amos que estar volviendo de un viaje de 15 d√≠as por Bali, Gili y Nusas. Como se cancel√≥ todo, nos han devuelto el dinero. As√≠ que intentaremos volver el pr√≥ximo a√Īo o cuando nos dejen. Ya conocemos Bali y las Gili pero hay muchos lugares por descubrir en esa espectacular regi√≥n del Planeta, a parte de que nuestra hija no lo conoce y ser√≠a su primera vez all√≠...

Saludos.
malik
Malik
Dr. Livingstone
Dr. Livingstone
Sep 15, 2009
Mensajes: 9026

Fecha: Mie Sep 30, 2020 09:20 am    T√≠tulo: Re: Qu√© Visitar en Bali: Dudas generales, Itinerarios

no conozco las Gili, por lo que no puedo comparar. en mi viaje eran mi primera opci√≥n, pero fue el mismo mes de los terremotos que sacudieron a las gili, por lo que cambi√©, y la verdad es que no qued√© decepcionado. por lo que le√≠ e investigu√© de las gili, y por lo que vi in situ en las nusas, son islas distintas. las gili mas destinadas al relax, creo yo. yo en las nusas par√© poco, la verdad...entre playa, manglares, moto, snorkel...aunque si quieres relax, por supuesto que lo encontrar√°s, en ceningan hay varios sitios espectaculares para ello, con su agua turquesa, sus columpios...  Leer m√°s ...
malik
Malik
Dr. Livingstone
Dr. Livingstone
Sep 15, 2009
Mensajes: 9026

Fecha: Mie Sep 30, 2020 09:21 am    T√≠tulo: Re: Qu√© Visitar en Bali: Dudas generales, Itinerarios

vaya faena, por mucho que uno entre en el foro y lea este tipo de comentarios, no deja de sentir pena por la situación y los viajes cancelados.
esperemos que pronto podamos volver a la normalidad, pero no a la nueva, sino a la antigua. Amistad
jj70
Jj70
Travel Addict
Travel Addict
Ene 13, 2016
Mensajes: 65

Fecha: Mie Sep 30, 2020 09:22 am    T√≠tulo: Re: Qu√© Visitar en Bali: Dudas generales, Itinerarios

Muchas gracias!!!
CREAR COMENTARIO EN EL FORO
Respuesta R√°pida en el Foro
Mensaje:
Registrate AQU√ć